1

La tontería del día - Imaginario = Geobacillus kaustophilus (ATCATGGCCGGCATCAACGCCAGAATCNNN)

Buceando por los universos de internet encontré esta tontería, muy acorde para frikis (o geeks) como yo.
Su utilidad es absolutamente nula (quizá alguno de vosotros le encuentre alguna), pero ahí os la dejo.


Pues eso, si queréis saber cuál es vuestro nombre en ADN y a que ser vivo os parecéis (y estáis muy aburridos) visitad What's your name in DNA?


1 comentarios.:

Radagast dijo...

Me ha informado Jez que la "N" en el código genético significa "no sé que nucleótido va aquí". También me ha dicho que se usan X e Y para cuando se duda entre parejas de nucleótidos (aunque no recuerda cuáles)
Fíjate tú qué cosas.

----------------

name = *RADAGAST*

Your name in DNA:
AGAGCCGACGCCGGCGCCAGCACC

This DNA sequence is similar to the protein called Q9FAD7|CHEY_ENTCL.

This protein is found in the species Enterobacter cloacae.

----------------

Si ya sabía yo que no debí salir del cuarte de baño...

Publicar un comentario en la entrada

Los comentarios son moderados. No esperes ver tu comentario de inmediato.

Los comentarios evangelizantes o cualquier intento de salvar almas son bien recibidos, se expondrán en un lugar visible del blog para que podamos reírnos.
Lo mismo es aplicable para magufos, supersticiosos varios, conspiranoicos y demás iluminados de pobre o nula argumentación.


Códigos para comentarios:

Negrita: <b>TU TEXTO</b>
Cursiva: <i>TU TEXTO</i>
Enlace:<a href="http://www.pagina.com">Texto explicativo</a>

Gracias por comentar.

Nota: solo los miembros de este blog pueden publicar comentarios.

Related Posts Plugin for WordPress, Blogger...